Redescription of Coryphopterus tortugae (Jordan) and a new
allied species Coryphopterus bol
(Perciformes: Gobiidae: Gobiinae) from the tropical western Atlantic Ocean.
BENJAMIN C. VICTOR
Ocean Science Foundation, 4051 Glenwood, Irvine, CA 92604 and Guy Harvey Research
Institute,
Oceanographic Center, Nova Southeastern University, 8000 North Ocean Drive,
Dania Beach, FL
33004. E-mail: ben@coralreeffish.com
Abstract
A re-examination of the holotype and mtDNA barcoding confirms Garzon-Ferreira
and Aceros separation
of Coryphopterus tortugae from C. glaucofraenum. However, specimens matching
the markings of their
Santa Marta variant of C. tortugae comprise a distinct clade about 10% sequence
divergent from true
C. tortugae and C. glaucofraenum. The variant is described here as a new species,
the sand-canyon
goby Coryphopterus bol, from specimens collected in Puerto Rico, the US Virgin
Islands, and the
Atlantic coast of Panama. The new species is abundant and widespread in the
region and has not been
recognized as distinct from the bridled goby, C. glaucofraenum. C. bol can be
distinguished from C.
tortugae by markings: a dark oval spot on the lower third of the pectoral-fin
base, a chain-link pattern
of melanophores on the top of the head, and a thick C-shaped basicaudal mark
and scale-edges outlined
in lines of tiny melanophores on well-marked individuals. Putative bridled gobies
from three different
reef types were sampled: a wide and clearly-zoned shelf in the Greater Antilles
(off La Parguera, Puerto
Rico), a narrower mixed-zone island of the Lesser Antilles (St. Thomas, US Virgin
Islands), and narrow
fringing continental reefs in the Southern Caribbean (the Atlantic coast of
Panama near Portobelo). In
all three locations, C. bol was found in deeper and more offshore reef areas
with strong currents, i.e.
in the channels of the buttress-canyon zone just inshore of the drop-off in
Puerto Rico, around exposed
rocky points in St. Thomas, and on wave-swept reefs just offshore of the sediment-influenced
coastline in
Panama.
Victor, B.C. (2008) Redescription of Coryphopterus tortugae (Jordan) and a new allied species Coryphopterus bol (Perciformes: Gobiidae: Gobiinae) from the tropical western Atlantic Ocean. Journal of the Ocean Science Foundation 1: 1-19.
Key words. Gobiidae, Goby, New Species, BARCODE, BOLD, Fish, Identification,
DNA, Caribbean,
Western Atlantic, taxonomy and informatics.
Introduction
The bridled goby is one of the more common reef fishes of the tropical Atlantic,
abundant in any sandy
habitat adjacent to coral, rock, rubble or mangroves and found from the shoreline
to deep offshore reefs
(Bohlke and Chaplin 1993, Randall 1996). This goby shows extreme variation in
markings, from almost
completely pallid on white sand in clear water to dark with prominent stripes
and spots in other habitats.
As a result, it has been alternately split into separate species or combined
into one. The prevailing view
has been to unite the marking variations into the single species Coryphopterus
glaucofraenum (Gill)
(Bohlke and Robins 1960, Murdy and Hoese 2002).
More recently, Garzon-Ferreira and Acero (1990) redescribed the well-known pallid
variant as
Coryphopterus tortugae (Jordan) and separated it from C. glaucofraenum. They
demonstrated that C.
glaucofraenum has a squared-off two-pointed head-stripe marking and a basicaudal
mark consisting of
two colon-like spots, while C. tortugae have a simple triangular head-stripe
marking, a basicaudal mark
made up of a bar, and a lesser body depth. Their putative C. tortugae included
both heavily-marked and
pale forms, shallow and deep collections, and samples from an isolated offshore
island (Isla Providencia)
as well as the continental coast (Santa Marta, Colombia). Their separation has
not been generally
accepted, but Greenfield and Johnson (1999) did distinguish between the two
species in their habitat study
in Belize. In the course of my collaboration with the Barcode of Life project,
Fish-BOL (Ratnasingham
and Hebert 2007), in which we used mtDNA sequences to link larvae to adults
of Coryphopterus spp.
gobies, I confirmed Garzon-Ferreira and Aceros separation. However, I
found that not only are the
specimens fitting the description of C. tortugae according to Garzon-Ferreira
and Acero (1990) clearly
sequence divergent from classic C. glaucofraenum, but, furthermore, that putative
C. tortugae divided
into two clearly-separated clades, mostly segregated by habitat in my collections.
Materials and Methods
Counts, measurements, and techniques follow Randall (2001). All fish lengths
are standard length (SL).
SIO is the institutional abbreviation for the Marine Vertebrate Collection of
the Scripps Institution of
Oceanography. AMNH is the American Museum of Natural History, SU is the Stanford
University
collection at the California Academy of Sciences, PMNH is the Peabody Museum
of Natural History
at Yale University, and SMF represents the Senckenberg Museum Frankfurt. The
mitochondrial
DNA sequences were obtained, processed, and archived following the BOLD procedure
outlined in
Ratnasingham and Hebert (2007). The phylogenetic tree was generated by 2-parameter
distance metrics
for sequence comparisons (Kimura) and genetic distances were calculated using
the bold Management
and Analysis System (www.barcodinglife.org).
Coryphopterus bol, new species
Fig. 1
Coryphopterus tortugae (not of Jordan, in part), Garzon-Ferreira and Acero 1990:
107, Fig. 1A (Santa
Marta region).
Holotype. SIO-08-69, 26.8 mm SL, female, Puerto Rico, La Parguera, Bosque near
UPR-MIML dropoffmooring (17.887, -67.018), 18 m depth, sand canyon, dipnet,
B. Victor and C. Caldow, Aug. 5, 2007.
Paratypes. SIO-08-70, 1: 24.5 mm SL, United States Virgin Islands, St. Thomas,
Outer Brass Island
(18.401, -64.976), B. Victor, June 29, 2006; SIO-08-71, 9: 18.5-31.0 mm SL.
Panama, Colon District,
Salmedina Reef (9.569, -79.697), D.R. Robertson, B. Victor, and J. Van Tassell,
May 30, 2007; SIO-08-72,
13: 15.3-31.0 mm SL. Panama, Colon District, Islas de las Dos Hermanas (9.597,
-79.667), D.R. Robertson
and J. Van Tassell, June 2, 2007; SIO-08-73, 5: 23.7-28.2 mm SL. Puerto Rico,
La Parguera, Bosque near
UPR-MIML dropoff-mooring (17.887, -67.018), B. Victor and C. Caldow, Aug. 5,
2007; SIO-08-74, 1: 32.1
mm SL. La Parguera, Medialuna Reef, seaward slope, (17.939, -64.047), B. Victor,
Aug. 9, 2007.
Non-type materials. AMNH 33576, 92: 10.0-40.0 SL, U.S. Virgin Islands, St.
John, Lameshur Bay,
Tektite site, C. L. Smith and J. C. Tyler, Sep. 10, 1973 (labeled C. glaucofraenum);
AMNH 239836, 5:
23.5-32.0 SL, Curacao, Saba Tugboat (12.0808, -68.8885), D.R. Robertson, J.S.
Sparks and S. Piontek,
Feb. 11, 2005 (labeled C. eidolon); AMNH 239847, 14: 25.6-39.9 SL,
Curacao, Saba Tugboat (12.0808,
-68.8885), D.R. Robertson, J.S. Sparks and S. Piontek, Feb. 11, 2005 (labeled
C. glaucofraenum);
AMNH 239861, 2: 30.8-34.9 SL, Curacao, Klein Curacao (11.9852, -68.6456), D.R.
Robertson, J.S. Sparks
and P. Hoetjes, Feb. 12, 2005 (labeled C. glaucofraenum).
Diagnosis. A species of Coryphopterus with modal dorsal elements VI, I,9; anal
fin elements I,9;
pectoral fin rays 19; longitudinal scale series 26-27; pelvic fins fully joined
medially by membrane,
innermost rays branched and about equal in length to the next ray and a distinct
frenum between the two
pelvic fin spines; a prominent, dark, upward-pointed triangle-marking on the
stripe behind the eye, no
bar of melanophores from the eyeball at 8 oclock to the mid-maxillary,
a discrete oval, rectangular, or
rounded collection of small melanophores on the lower third of the pectoral
fin base and, on more darklymarked specimens, a chain-link pattern of lines
on the top of the head with a complete upper-eye stripe,
the exposed scale-edges on the upper body outlined with tiny melanophores, and
a basicaudal marking
that is a thick C-shape.
Description.
Dorsal elements VI, I,9; anal elements I,9; all dorsal and anal soft rays
branched, the last
to base; pectoral rays 19 (18-20), the upper and lowermost unbranched; pelvic
elements I,5 with the
rays all branched, united as a disk with a rounded edge, the innermost ray about
equal to the next, a
distinct frenum; branched caudal rays 12, upper unbranched caudal rays 9, posterior
3 segmented; lower
unbranched caudal rays 8, posterior 2 segmented; longitudinal scale series 26-27;
transverse scale series
7; circumpeduncular scales 12; gill rakers 2+6; branchiostegal rays 5; vertebrae
9+17; spinous dorsal-fin
pterygiophore formula 3-22110.
Morphology varies with depth in this genus, specimens from deeper waters with
stronger current flows
are slimmer with more pointed snouts and have more prominent midline nuchal
crests (or ridges) on
the head. Measurement ranges listed here include the holotype, a typical pallid
deeper-water specimen
(in parentheses), along with three paratypes including one from shallower waters
(Medialuna Reef at
La Parguera, Puerto Rico). The latter specimen was captured along with numerous
C. tortugae and the
morphology of the two species from the same location was remarkably similar
(fig. 2).
Body elongate, depth 4.26-4.74 (4.27) in SL, and compressed, width at pectoral
fin base (side-to-side) 1.26-1.4 (1.4) in
depth; ventral part of head and chest broad and nearly flat; head triangular
when viewed from above,
its length 3.17-3.71 (3.17) in SL, midline head ridge usually prominent; snout
pointed, its length 4.1 to
5.14 (4.45) in head; orbit diameter 2.85-3.3 (3.3) in head, the eye extending
above dorsal profile of head;
interorbital space extremely narrow, 35.3-37 (36.5) in head; caudal-peduncle
depth 2.03-2.54 (2.54) in
head; caudal-peduncle long, its length 1.2-1.39 (1.38) in head. Mouth large,
the maxilla ending below
anterior 1/3 of pupil, the upper-jaw length 2.1-3.0 (2.89) in head; lower jaw
projecting; mouth oblique;
upper jaw and lower jaws with multiple rows of well-spaced-apart slender curved
conical teeth. Tongue
truncate with rounded corners.
Gill opening extending forward to below middle of opercle. Gill rakers on the
first arch 2+8 in a paratype.
Head naked except for scales on side of nape extending forward nearly to eye;
no scales on fins except a
few on base of caudal fin that are smaller than largest scales on body. Scales
ctenoid except those on side
of nape, thorax, prepectoral area, and a few just above base of pelvic fins
that are cycloid. Anterior nostril
a short membranous tube at level of middle of eye. Head pores prominent, as
follows: a nasal pore, an
anterior and a posterior interorbital pore, a postorbital pore, an infraorbital
pore below the postorbital, a
pore at each end of a lateral sensory canal; a short posterior lateral canal
with a pore at each end, and 3
preopercular pores (i.e. Birdsongs B, C, D, E, F, G, H, K,
L, M, N, O). Head papillae in rows vertically
along the lower opercle and along the lower rim of the preopercle extending
forward along the line of the
lower jaw.Origin of dorsal fin behind upper base of pectoral fin, predorsal
distance 2.76-3.18 (2.79) in SL; spines of
fins slender and flexible; 1st dorsal fin lower than 2nd; 1st dorsal spine 1.5-1.74
(1.74) in head, sixth spine
much shorter; spine of 2nd dorsal fin about 1.8 in head; 1st dorsal soft ray
longest, about1.7 in head; origin
of anal fin below base of 1st soft ray of 2nd dorsal fin, preanal distance 1.6-1.77
(1.77) in SL; anal spine
about 3.1 in head; caudal fin moderately rounded, 3.42-3.94 (3.94) in SL; pectoral
fins pointed, the middle
rays longest, 3.4-3.7 (3.67) in SL; origin of pelvic fins directly beneath base
of pectoral fins, prepelvic
distance 3.1-3.58 (3.07) in SL; pelvic fins fully joined by membrane; pelvic
frenum present; pelvic spine
about 4.2 in head; 5th pelvic soft ray longest, nearly reaching origin of anal
fin, its length 1.0-1.37 (1.37) in
head; 4th pelvic soft ray about 95% length of 5th ray.
Markings vary substantially with habitat (fig. 1): those individuals on white
sand bottoms in clear deep
water on Caribbean islands are very pale with few dark markings. In shallower
sand habitats at the same
locations, individuals show more dark markings and, on rocky bottoms, individuals
can be quite heavilymarked.
On continental coasts, where water clarity is usually lower, even the individuals
on white sand
bottoms have distinct markings on the upper half of the body. Pallid individuals
found on pure white
sand have few melanophores, primarily in a major dark stripe rearward from the
mid-level of the eye
swelling into an upward-pointing triangle usually prominent above the operculum
(sometimes followed by
an additional smaller triangle). At the very end of the stripe, there is a large
rounded spot of melanophores
on the upper body below the origin of the dorsal fin, about the size of the
pupil. Below that stripe is an
under-eye dark stripe overlying a broad iridescent stripe along the cheek which
comprises the bridle of
the bridled gobies. The under-eye stripe extends back to the upper third of
the pectoral fin base. Above the
major mid-level stripe there is a dark upper-eye stripe. Notably, in this species,
this stripe often develops
even on lightly-marked individuals and is usually complete (i.e. not broken
into short segments) extending
back to the level of the origin of the dorsal fin. On pallid individuals the
pattern of melanophores on top
of the head is quite variable; sometimes none, but most often short lines of
melanophores just alongside
the midline in two locations: just forward of the dorsal fin origin and then
midway to the interorbital (typically not isolated rounded collections of small
melanophores). The short lines often bracket a
distinctly unpigmented midline. As pigmentation advances, lyre-like lines of
melanophores extend
laterally from these two points to begin to form the chain-link pattern of melanophores
on the top of the
head. Additional melanophores on the head comprise small patches of melanophores
on the operculum, at
the corner of the jaw, and on the snout forward of the eyes.
There is typically a line or patch of melanophores across the upper third of
the pectoral fin base, above
an iridescent stripe occupying the center of the pectoral fin base and below
an iridescent saddle at the top
edge of the pectoral fin base (line can be absent on the most pallid individuals).
There is a matching line
of melanophores on the inward-facing axillary surface of the fin. On virtually
all individuals over about
25 mm SL there is a discrete patch of melanophores on the lower third of the
pectoral fin base. The patch
is most often a distinctly oval or rectangular spot typically somewhat concave-facing
dorsad, but, in some
individuals, the patch can be rounded. On the most pallid individuals with very
few melanophores (and
typically with none on top of the head), the lower-third patch can be absent
or reduced to just three or four
centrally-placed small melanophores. On the dorsal midline of the body there
are six dark spots evenly spaced along the base of the dorsal fins, ending with
several thin saddle lines of melanophores spaced
along the top of the caudal peduncle. A row of short bars of melanophores runs
along the lateral body just
below the midline. On lightly-marked specimens the basicaudal bar of melanophores
can be a simple bar,
but often there are some tiny melanophores trailing onto the caudal fin base
to form a C-shape. Rarely, the
bar is split at the midline, but not into two distinctly-rounded spots. On many
lightly-marked specimens
some upper-body scales have lines of tiny melanophores outlining the exposed
scale-edges.
Well-marked individuals develop additional melanophores: on the head, patches
of melanophores extend
along the anterior and mid-maxillary and the patch at the corner of the jaw
extends up to meet the undereye dark stripe (but note there is no discrete dark
bar extending from 8 oclock on the iris to the midmaxillary, as is found
on C. eidolon and often on C. thrix). The patch at the corner of the jaw extends
back
as an additional dark stripe across the lower cheek and curves up to meet the
under-eye stripe at the edge
of the operculum. On the pectoral fin base, there is often a collection of melanophores
within the central
iridescent stripe, in addition to the standard upper-base stripe and the characteristic
lower-base spot.
On the body there is an additional lateral row of short bars of melanophores
above the lateral midline. The bars and caudal peduncle spots often develop
into irregular X shapes. In the darkest individuals,
most scales on the body have thin lines of tiny melanophores outlining their
exposed edges. A dark line
underlies the mid-portion of the anal fin and three more dark lines are spaced
along the ventral midline
of the caudal peduncle. In most darker individuals the basicaudal bar is a distinct
thick C-shape with
marked extensions of melanophores extending onto the caudal fin. Breeding adults
develop a uniform
scattering of small melanophores over the branchiostegal rays, on the chest
around the pelvic fin origin,
and concentrated on the pelvic fin membranes.
Color in life. Live individuals are mostly translucent with colors limited to
shades of orange and
iridescent blue (figs. 3 and 4). In addition to the melanophore patterns described
above, live individuals
have iridescent white markings in stripes from the eye to the tip of the jaw
and between the dark stripes
below the eye (the bridle) and across the cheek. The white bridle stripe extends
across the middle of the
pectoral fin base and onto the central fin rays and the white stripe above the
bridle extends onto the
shoulder of the pectoral fin base. Rounded iridescent spots sit above the main
dark eye-stripe behind
the eye, bracketing the black triangle extensions from the stripe. Iridescent
round spots speckle the side
of the body and patches of white spots are present between the black spots along
the dorsal midline.
Orange pigment surrounds and fills in the black spots and stripes. On the side
of the body below the
lateral midline, rounded orange spots are bracketed by the bars and Xs of fine
melanophores.
Particularly prominent in live specimens from deeper waters are large black
spots on the iris in a clockface pattern, usually placed at 12, 1:30, 3, 9 and
11 oclock (figs. 5 and 6). Some individuals have an
additional spot at 7 oclock. Notably, the paratypes from shallower reefs
(Medialuna in Puerto Rico and
Outer Brass Island in St. Thomas) have less prominent clock-face spots since
the entire surface of the iris
has a dark underlying shading (likely an adaptation to protect the iris from
sunlight)(fig. 7). The pupil is
often ringed by a bright orange-yellow circle. On the interorbital side of the
eyeball there are two or three
oblique thick black bars over the eyeball membrane. Internal body markings include
a central dark strip,
often tinged with orange, along with an iridescent band running above the brain-case
and spinal column,
usually breaking into dark patches: below the first dorsal fin, the front of
the soft dorsal fin, the mid-fin,and then below the end of the fin. A dark band
covers the anterior dorsal peritoneal lining and an opaque
white layer lines the abdominal wall. The medial fin membranes are tinged orange
with bluish stripes and
edging.
Barcode sequence. A 651-nucleotide sequence of the section of COI gene used
for barcoding by the
BOLD informatics database (Ratnasingham and Hebert 2007) was obtained for the
holotype (Genbank
accession number EU567148). Following the database management recommendation
of the BOLD the
sequence of the holotype is presented here as well:
CCTTTATTTAGTTTTTGGTGCCTGAGCCGGAATAGTAGGGACTGCATTAAGCCTTCTTATCCGGCTGA
ACTTAGTCAACCGGGGGCCCTCCTCGGAGATGACCAAATTTACAATGTTATTGTAACTGCCCCGCAT
TTGTTATAATTTTCTTTATAGTAATACCGATTATGATTGGGGGATTTGGAAATTGACTTATCCCACTAAT
GATCGGGGCCCCTGATATAGCTTTCCCCCGAATAAACAACATAAGCTTTTGACTCCTTCCTCCATCGT
TCCTACTTCTTTTAGCATCGTCAGGCGTAGAAGCTGGTGCCGGGACTGGCTGAACCGTGTACCCCCC
CCTTGCCGGCAATTTAGCCCATGCAGGAGCATCAGTAGACTTGACCATTTTCTCCTTCATTTGGCTGG
TGTCTCTTCAATTCTAGGGGCAATCAACTTCATTACTACAATTTTAAACATGAAACCTCCTGCCACC
Distribution. Individuals that are mtDNA-sequence confirmed were collected from
Puerto Rico, the
US Virgin Islands, and the Atlantic coast of Panama. Fish matching the physical
description of the new
species are present throughout the region from Florida to the southern Caribbean.
Etymology. The new species is named for the Barcode of Life project which was
instrumental in
distinguishing the species and in recognition of the efforts of the FishBol
team under Robert Hanner.
Since BOL is an acronym and neither Latin nor latinized, it is treated as indeclinable
and retains the
original spelling (ICZN Article 31.2.3, 2007).
Common Name. The common name of sand-canyon goby is suggested to distinguish
the species by its
predilection for the buttress-and-canyon sand habitat (note that spur-and-groove
is a misnomer fide T.J.
Goreau). Most markings are shared among closely-related species and names such
as bridled and pallid do
not discriminate between species.
Comparisons. There are ten Caribbean species in the group of sand-perching gobies
of the genus
Coryphopterus. There is some small variation in fin-ray counts and pelvic fin
morphology that helps
distinguish a few species. Nevertheless, marking patterns are required to separate
the several species
within the clade that share 10 second dorsal fin elements and 10 anal fin elements.
The new species Coryphopterus bol is separated from its congeners by the following
features (those listed
not shared by C. bol):
Coryphopterus lipernes (Bohlke and Robins) is a colorful coral-dwelling blue-striped
peppermint goby; it
has divided pelvic fins and fewer pectoral fin rays (16-18).
Coryphopterus personatus (Jordan and Thompson) and Coryphopterus hyalinus (Bohlke
and Robins) are
hovering, not benthic, species with divided and unmarked pelvic fins, dark masks
from the snout through
the eye and black rings around the anus (Bohlke and Robins 1960, 1962; Randall
1996).
Coryphopterus kuna (Victor) has 9 second dorsal and anal fin elements and only
15 pectoral fin rays and
does not have the black stripes on the head characteristic of the 10/10 fin-element
group. In addition, it
has two rows of small black spots across the upper iris and top of the eyeball
(Victor 2007).
Coryphopterus alloides (Bohlke and Robins) has 9 anal fin elements, divided
pelvic fins, and fewer
pectoral fin rays (16-17).
Coryphopterus dicrus (Bohlke and Robins) has no pelvic fin frenum (as large
juveniles and adults) and
the innermost pelvic fin rays are distinctly shorter than the next ray, forming
a notched pelvic fin outline,
as well as colon-like spots on the pectoral fin base (notably the upper spot
is also distinctly rounded).
Coryphopterus thrix (Bohlke and Robins) has a characteristic large black spot
fully-covering the upper
half of the pectoral fin base, often an extended second spine on the first dorsal
fin, often a bar or a
few melanophores running from the eye at 8 oclock to the mid-maxillary,
and, most distinctive, small
reticulated black spots on the upper surface of the eyeball (pers. obs.).
Coryphopterus punctipectophorus (Springer) has 11 second dorsal fin elements
and a long linear streak of
melanophores along the midline of the head behind the interorbital (pers. obs.).
Coryphopterus glaucofraenum (Gill) has a basicaudal mark consisting of colon-like
spots (or a barbell
shape with rounded tips) and the triangular mark above the operculum is two-pointed
at the apex and
squared-off (Garzon-Ferreira and Acero 1990).
Coryphopterus venezuelae (Cervigon) resembles C. glaucofraenum and has 11 (on
my count it is often 12)
second dorsal and anal fin elements (Springer 1960, Cervigon 1966, 1994).
Coryphopterus eidolon (Bohlke and Robins) can appear quite similar to C. bol
but has shortened
innermost pelvic fin rays and a notched pelvic fin outline. Both pallid (traditionally
illustrated in
books and guides and listed in museum collections) and well-marked specimens
(usually labeled as C.
glaucofraenum) have a distinctive discrete bar of melanophores extending from
the eye at 8 oclock to the
mid-maxillary and most have an upturned short line of melanophores behind the
corner of the jaw (pers.
obs.).
Coryphopterus tortugae (Jordan) is closest in appearance to C. bol, but differs
by having no discrete spot
of melanophores on the lower third of the pectoral fin base. In addition, they
have prominent spots along
the dorsal midline of the head that are isolated and discrete collections of
fine melanophores (typically
rounded and centered on the midline vs. linear and to the side of the midline
and with connecting loops
of melanophores in a chain-link pattern in C. bol). The upper-eye stripe (above
the major stripe extending
behind the mid-level of the eye) is usually incomplete, often broken into short
segments (or absent) while
in C. bol the upper-eye stripe is usually complete without a break to the level
of the dorsal fin origin, even
before the central region develops many markings (fig. 7).
Many shallow-water C. tortugae have short snouts, shorter than those exhibited
by C. bol (fig. 7), often
with a snout length from 5.5 to 7 times into the head length (snout length measured
from the dorsal aspect
from the tip of the upper jaw back to the level of the front of the eyeballs
and head length from the tip of
the upper jaw to the level of the posterior edge of the operculum). Nonetheless,
some populations of C.
tortugae have longer snouts that completely overlap with measurements from C.
bol (e.g. 4.0-4.9 snouts in
head on Medialuna Reef). Thus far, all of the C. bol I have examined have longer
snouts (all are between
4.0 and 5.2 snouts in head), but, given the variability in morphology exhibited
within these gobies, this
may not be a rule.
Extremely pallid specimens of C. bol lacking melanophores on top of the head
and on the pectoral fin
base can be impossible to distinguish from the most lightly-marked C. tortugae.
Similarly, larvae and
juveniles of Coryphopterus spp. that are pallid with incomplete markings can
overlap completely in
appearance.
Coryphopterus tortugae (Jordan)
Figs. 8 and 9
Ctenogobius tortugae Jordan, Bull. U.S. Fish Comm. 1904, vol. 22 for 1902, 541-542,
pl. 1 (Garden Key,
Dry Tortugas, Florida). Longley and Hildebrand (1941):232; Bohlke and Robins
(1960):107, synonymized
with Coryphopterus glaucofraenum (Gill); Garzon-Ferreira and Acero (1990):105-112
(in part)(Isla de
Providencia, Colombia).
Coryphopterus glaucofraenum (not of Gill, in part), Longley and Hildebrand (1941)
232-233; Bohlke and
Robins (1960):106-112, pl. 1; Bohlke and Chaplin (1968):595; Randall (1983):249-250;
Robins, Ray, and
Douglass (1986): 244.
Ctenogobius transparentus Klausewitz 1958, Senckenbergiana Biol. 39:78-80 (Bonaire).
Holotype. SU 8363 (=SU 8568), 41.0 mm SL, female, Florida, Dry Tortugas, Garden
Key, J.C. Thompson.
Diagnosis. A species of Coryphopterus with modal dorsal elements VI, I,9; anal
fin elements I,9; pectoral
fin rays 19; longitudinal scale series 26-27; pelvic fins fully joined medially
by membrane, innermost
rays branched and about equal in length to the next ray and a distinct frenum
between the two pelvic fin
spines; a prominent, dark, upward-pointed triangle-marking on the stripe behind
the eye, no collection of
small melanophores on the lower third of the pectoral fin base, no bar of melanophores
from the eyeball at
8 oclock to the mid-maxillary, two or three discrete spots along the dorsal
midline on the top of the head
between the interorbital and dorsal fin, usually an incomplete upper eye-stripe,
and a basicaudal marking
that is typically a simple vertical bar.
Description. Meristics and morphology follow Bohlke and Robins (1960) and Garzon-Ferreira
and Acero
(1990) and broadly overlaps C. bol described above, and therefore are not repeated
here. Markings are
distinctive. Specimens in alcohol vary from pallid with scant markings to well-marked.
Pallid individuals have few melanophores, primarily in a major dark stripe
rearward from the mid-level
of the eye swelling into an upward-pointing triangle usually prominent above
the operculum (sometimes
followed by an additional smaller triangle). At the very end of the stripe,
there is a large rounded spot of
melanophores on the upper body below the origin of the dorsal fin, about the
size of the pupil. Below that
stripe is an under-eye dark stripe overlying a broad iridescent stripe along
the cheek which comprises the
bridle of the bridled gobies. The under-eye stripe extends back
to the upper third of the pectoral fin
base. Above the major mid-level stripe there is a dark upper-eye stripe. Notably,
in pallid individuals of
this species, this upper-eye stripe is typically incomplete, often broken into
short segments (or sometimes
absent). On these pallid individuals, the pattern of melanophores on top of
the head can vary; sometimes
none, but usually two or three obvious isolated spots along the midline forward
of the dorsal fin origin.
The one closest to the dorsal fin is often rounded or a short transverse bar
while the central one is
typically a clearly rounded collection of small melanophores. Often there is
a third spot forward, nearer
the interorbital. Additional melanophores on the head comprise small patches
of melanophores on the
operculum, at the corner of the jaw, and on the snout forward of the eyes. There
is typically a line or patch
of melanophores across the upper third of the pectoral fin base, below an iridescent
saddle at the top edge
of the pectoral fin base and above an iridescent stripe occupying the center
of the pectoral fin base. There
is a matching line of melanophores on the inward-facing axillary surface of
the fin. There are typically
no melanophores on the lower third of the pectoral fin base. On the dorsal midline
of the body there are
six dark spots evenly-spaced along the base of the dorsal fins, ending with
several thin saddle lines of
melanophores spaced along the top of the caudal peduncle. A row of short bars
of melanophores runs along the lateral body just below the midline. A tenuous
and quite variable basicaudal bar of melanophores
is present, occasionally split at the midline (but not into two distinctly-rounded
spots).
Well-marked individuals develop additional melanophores: on the head, patches
of melanophores occur
along the mid-maxillary, the patch at the corner of the jaw extends up to meet
the under-eye dark stripe
and extends back as an additional dark stripe across the lower cheek then curves
up to meet the under-eye
stripe at the edge of the operculum. On the pectoral fin base, there is often
a collection of melanophores
within the central iridescent stripe in addition to the standard upper base
stripe, but there is distinctly no
discrete collection of melanophores on the lower third of the pectoral fin base.
Breeding adults with fullyspeckled undersides can have some extension of the
light uniform speckling onto the lower third of the
pectoral fin base, but not in a discrete collection. On the body, there is an
additional lateral row of short
bars of melanophores above the lateral midline. The bars and caudal peduncle
spots often develop into
irregular X shapes.
Holotype. The holotype of Coryphopterus tortugae is a somewhat pallid adult
female with typical
markings. She has faded markings, but small melanophores are quite distinct
and even the fine ventral
speckling over the branchiostegals, chest, and pelvic fins is clearly visible
(generally found in mature
adult sand gobies). Notably for species identification, there are no melanophores
on the lower third of
the pectoral fin base, there is an obvious discrete rounded collection of small
melanophores at the dorsal
midline of the head (and no chain-link reticulations adjacent to the midline),
and the upper-eye stripe
above the main stripe behind the eye is clearly broken into short segments (fig.
9). The holotype has a
short snout (5.3 snouts in head), out of the range of the C. bol I have examined.
The engraving illustrating
this holotype in Jordan (1904) shows only a few large spots and no fine detail
and, furthermore, the
measurements of snout and head lengths from the illustration are nowhere near
the measurements from
the specimen (a caution against using morphometrics from drawings). The holotype
is from a collection of
small shallow-water reef species collected long before any diving technology
was available and thus the
collection of C. tortugae instead of the deeper-water C. bol is to be expected.
Color in life. Live individuals are mostly translucent with colors limited
to shades of orange and
iridescent blue. In addition to the melanophore patterns described above, live
individuals have iridescent
white markings in stripes from the eye to the tip of the jaw and between the
dark stripes below the eye
(the bridle) and across the cheek. The bridle stripe extends across the middle
of the pectoral fin base and
onto the central fin rays and the stripe above the bridle extends onto the upper
edge of the pectoral fin
base. Rounded iridescent spots sit above the main dark eye-stripe behind the
eye, bracketing the black
triangle extensions from the line. Iridescent round spots speckle the side of
the body and patches of white
spots are present between the black spots along the dorsal midline. Orange pigment
surrounds and fills in
the black spots and stripes. On the side of the body below the lateral midline,
rounded orange spots are
bracketed by the bars and Xs of fine melanophores.
Specimens from deeper clear water have large black spots on the iris in a prominent
clock-face pattern,
usually placed at 12, 1:30, 3, 9 and 11 oclock (fig. 6). Occasional individuals
have an additional spot at 7
oclock. C. tortugae found in relatively shallow waters have the iris spots
subdued by a background darkshading of the surface of the eyeball (likely an
adaptation to protect the eyeball from sunlight)(figs. 2 and
7). The pupil is often ringed by a bright orange-yellow circle. On the interorbital
side of the eyeball there
are two or three oblique black bars over the eyeball membrane. Internal markings
include a central dark
strip, often tinged with orange, along with an iridescent band running above
the brain-case and spinal
column, usually breaking into dark patches: below the first dorsal fin, the
front of the soft dorsal fin, the
mid-fin, and then below the end of the fin. A dark band covers the anterior
dorsal peritoneal lining and
an opaque white layer lines the abdominal wall. The medial fin membranes are
tinged orange with bluish
stripes and edging.
Junior synonyms. The holotype of Ctenogobius transparentus Klausewitz (SMF
4155) has three spots
along the dorsal midline, no lines or chain-links of melanophores connecting
the spots, and no upper
eye-stripe. This marking pattern is typical of C. tortugae. There is a scattering
of melanophores covering
the branchiostegal membranes, the pelvic fin membranes, and the chest which
does extend onto the lower
pectoral fin base, but not in a discrete spot or collection. This pattern of
ventral speckling spreading
marginally onto the pectoral fin base is characteristic of breeding adults of
C. tortugae. In addition, the
holotype has a short snout (5.5 snouts in head), out of the range of the C.
bol I have examined.
The holotype of Lophogobius pallidus Parr, a junior synonym of C. glaucofraenum,
(Bingham
Oceanographic Collection ICH 2534, PMNH Yale University) was photographed by
Gregory WatkinsColwell and he kindly provided the photograph which confirms
the identification as C. glaucofraenum.
The identification is further confirmed by the collection site within a mangrove
channel at Crooked Island,
Bahamas. The bridled gobies that live in mangrove channels are almost invariably
C. glaucofraenum.
Common Name. The common name of patch-reef goby is suggested to distinguish
the species by its
predilection for shallow clear water-reefs. Most markings are shared among closely-related
species and
names such as bridled and pallid do not discriminate between species.
DNA Sequences. The phylogenetic tree generated from mtDNA barcode COI sequences
for
Coryphopterus spp. (with Priolepis hipoliti as the outgroup) reveals that C.
bol, C. tortugae, and C.
glaucofraenum form a clade within the genus, with each of the three species
about 10% divergent from
the others (fig. 10). Within-species variation in the Caribbean was very low:
among 35 specimens of C.
bol and 45 of C. tortugae there was less than 1% intra-specific sequence variation
and the majority of
individuals had identical sequences of 652 bp. Geographic variation in sequences
was not apparent, most
specimens shared identical sequences with conspecifics from opposite sides of
the Caribbean (Panama
and Puerto Rico/USVI).
Habitat. An interesting zoning pattern was detected among the bridled gobies
of the region. Putative
bridled gobies from three different reef types were identified by barcode sequencing.
The sites examined
constituted a wide and clearly-zoned shelf in the Greater Antilles (off La Parguera,
Puerto Rico), a
narrower mixed-zone island of the Lesser Antilles (St. Thomas, US Virgin Islands),
and narrow fringing
continental reefs in the Southern Caribbean (the Atlantic coast of Panama near
Portobelo). Bridled
gobies collected in far inshore locations, in mangrove areas or silty shallows,
were almost exclusively C.
glaucofraenum. In shallow sandy bays with clear water and some coral growth,
both C. glaucofraenum
and C. tortugae were present. In areas of shallow patch reefs, clear water,
and low currents the vast
majority of bridled gobies comprised C. tortugae. In all three locations, C.
bol was found in deeper and
more offshore reef areas with strong currents: in the channels of the buttress-canyon
zone just inshore of
the drop-off in Puerto Rico, around exposed rocky points in St. Thomas, and
on wave-swept reefs just
offshore of the sediment-influenced coastline in Panama.
The morphology of sand gobies varies greatly and matches the habitat type.
As can be seen in the
examples in figs. 1 and 7, shallower calm-water populations have deeper and
wider bodies, broader
and shorter snouts, and perhaps less development of the nuchal crest. As a result,
the three species of
bridled gobies would differ on average in morphology, however this difference
is mostly environmentallydetermined and should not be used a priori as a species
character. Indeed, the conclusion by GarzonFerreira and Acero (1990) that C.
glaucofraenum has a deeper body than both forms of C. tortugae, could
reflect the collection sites of the species. Typical collections of C. bol from
more offshore and highercurrent locations would be slimmer and longer specimens
with more pointed snouts. Similarly, the
prominence of the large black upper-eye spots on the iris varies with depth
(less apparent on shallower
specimens with extensive background shading on the eyeball), and thus the more
typical C. bol found in
museum collections show prominent eye spots, although those individuals captured
in shallow water have
the same eyeball shading as typical inshore C. tortugae and C. glaucofraenum.
Evaluating prior studies of the habitat distribution of the sand gobies in the
region is difficult, since the
three species are lumped as C. glaucofraenum. Interestingly, in the one large
habitat utilization study that
recognized C. tortugae, by Greenfield and Johnson (1999) in Belize, there were
two peaks of abundance
of putative C. tortugae: one in relatively shallow patch reef environments and
the other in the more
offshore buttress-canyon channels. It is likely that the latter group represents
C. bol and further studies
documenting habitat separation in the sand gobies should elucidate the generality
of these patterns.
Acknowledgements.
I appreciate the cooperation of the Smithsonian Tropical Research Institute
and the government of
Panama, the University of the Virgin Islands, and the University of Puerto Rico.
George Walsh and
Walsh Paper Distribution of Huntington Beach CA kindly sponsored preparation
and publication of the
project. In particular, I thank M. Shivji and D. R. Robertson for making the
expeditions to the USVI and
Panama possible. J. Blondeau, C. Caldow, S. Floeter, R. L. Gonzalez, A. Harris,
S. Kadison, A. Marshak,
R. Nemeth, C. Nolan, E. Pena, E. Rappaport, B. Ruttenberg, L. Tornabene, J.
Van Tassell, H. Valles,
G. Watkins-Colwell, B. Wetherbee, and the crew of the R/V Urraca provided invaluable
assistance in
the field and elsewhere. The cooperation of H.J. Walker (radiographs) and P.
Hastings at the Marine
Vertebrate Collection of the Scripps Institution of Oceanography and P. Brueggeman
at SIO Library is
appreciated. D. Catania and J. Fong provided photos of the holotype of C. tortugae
from the California
Academy of Sciences and H. Zetzsche provided photographs from the Senckenberg
Museum. L. and
K. Wilk and P. Ryan graciously provided photographs of gobies. S. Schaeffer
and staff at the AMNH
were very helpful. R. Hanner and the BOLD team, C. Maitland, A. Borisenko, R.
Breese, and G. Downs,
provided exceptional service with barcoding and efficiently managing the informatics
side of the project.
References